Why does anything matter if we all die, anyways? Ever think of that you fucking Nazis?

Why does anything matter if we all die, anyways? Ever think of that you fucking Nazis?

Other urls found in this thread:

youtube.com/watch?v=R-sYDf0YGv4
twitter.com/NSFWRedditVideo

What if we don't all die? What then?

Yeah okay, this is the real world. No one is immortal.

Can you prove that?
You make the assumption as if it is the only possibility.

The meaning of life is to secure the existence of your people and a future for white children. It's written right there in your DNA if you could read it.
"GTCGACGTACGACTGACACACACACTGTCGACGACTGACTGACTAGCTACGTACGATCGACTGACTGACTGACTAGCTACGTACGATCGTGTGCACGTAGCACGATCGATCGATCGATCGATCGA"
- Your mom on sexual reproduction

>haven't killed yourself after posting this
gtfo hypocrite

>Implying being a normie hedonist isn't the logical response to nihilism if you're not clinically depressed

Ah yes, the atheist """"""""""enlightenment""""""""""

I can fly when no one is looking. Can you prove I can't?

>Tfw I wasted my youth jacking off and making shitty music cause it was fun

The purpose of life is life

- Goethe

SORT YOURSELF OUT YOU POST MODERNIST TRASH

youtube.com/watch?v=R-sYDf0YGv4

whatever you have to do to convince yourself that sucking dick isn't gay user.

Because we're not faggots that only care about ourselves?

No

The way to succeed is to be able to look back on your life and say "I'm okay with this"
You won't get anywhere dwelling on all the maybes and what ifs

>The atheists conundrum
Shouldn't have let the Jews sway you that God isn't real, jackasses.
I know God's real, if for no other reason than the Jews say he's not.

life is just death in drag

nothing matters. the best thing we could do is kill ourselves, but we are all too cowardly to face the momentary pain and fright.

To live forever we only need to outlive you.

Why do you think the world went to shit so fast?
Jews push atheism because atheists are short-sighted.
They don't do things nearly as much to help future generations.
They focus on the here and now.
Atheist Baby-Boomers sold the west out to the Jews so that they could live the dream and pass off the suffering to the younger generations after they're dead.

That's a fair trade for an iPhone X desu

Damn leaf, you a cheap ho.

Are you more attractive than OP pic?
Wanna get me an iPhone?

If nothing matters then it's okay to be a nazi.

Fuck no I'm an ogre looking faggot. But I got money where the fuck do you live I will pay your ticket to America so you can come blow me.

i don't think my bf would like that desu

It's because after you die, you come back again to live in the world you helped create. All religions, including Judaism believe in reincarnation. The only exceptions are Christianity and Islam, which are Jewish golem religions meant for the Gentiles.

Islam and Christianity lead to a nihilistic mindset, and narrow one's views and plans to a length of time that is shy of 100 years. It is in this way that we have been consistently outmaneuvered by Jews, who plot on the scale of a thousand years (Jews have been profiteering from European wars, and involved in money lending since the dark ages).

Return to the old gods and cleanse yourself of the impurity of nihilism, and gain once again a time preference that is actually better than that of a literal fucking baboon.