One of the most overexposed factoids in modern science is our genetic similarity to the African apes, the chimpanzees and gorillas. But how do we know just how genetically similar we are to them?
What is that estimate based on? Comparisons of DNA sequence ignore qualitative differences, those of kind rather than amount. To take the smallest case, consider a different sequence of twenty DNA bases from the same region: CCTTGGGCCTCCCGCCAGGC in the baboon and CCTTGGGCTCCCGCCAGGCC in the orangutan. If you stack them, one above the other, and compare the sequences you'll notice that they actually differ substantially. Molecules have complex ways of generating insertions and deletions in DNA, which we are only beginning to understand. For example, a stretch of DNA from a ribosomal RNA gene is forty bases long in humans and fifty four bases long in orangutans. The sequences on either side match up perfectly. How do we know what bases correspond between the two species, how do we decide how many substitutions have occurred, when obviously some have been inserted and deleted as well? While we might choose the alignment with the smallest numbers of mutational events, we still have to decide whether a gap “equals” a substitution, or whether a gap should be considered rarer and, therefore, worth, say, five substitutions. The problem is that we cannot tell which DNA sequence alignment is right. Another misleading area of DNA sequence comparisons entails a consideration of the other end of the scale. The structure of DNA is built up of four simple subunits: adenine, guanine, cytosine, and thymine, or A, G, C, and T. Since genetic information is composed of DNA sequences, and there are only four elements to each DNA sequence, it follows that two DNA sequences can differ, on the average, by no more than 25 percent and this creates a statistical oddity.
If you believe humans and apes are similar you are a moron.
>American >is unable to read anything longer than hot pocket instructions
The shock I'm experiencing is immense.
Cameron Hughes
>MOM COME LOOK I INSULTED THE USA AGAIN
Logan Powell
I showed your post to a phd candidate in genetic engineering and he laughed pretty hard.
"Given his arguments, if they had been true, I would fully believe this human came from a banana."
Matthew Hall
yeah man we actually evolved from birds lololol amirite reddit science (tm)
Jordan Wright
Someone didn't get past Bio101. Hahahahahaha
Blacks are the closest race to apes and chimps. That is politically incorrect, but a FACT.
John Lee
>evolution provides the perfect arguments as to why the races are biologically different and will never be equal, why there are only two genders and they're biologically different and will never be equal, why it's defective to be gay or trans, why gender roles are real and shouldn't be perverted, why hierarchies are real and shouldn't be perverted, why property rights are real and shouldn't be perverted, why it's ok for humans to kill animals, ect ect, blowing out every liberal argument with the facts of reality >"conservative" christians throw all this out because their middle eastern book that's been mistranslated a dozen times and is ripping off other religions a dozen times said their jewish god made earth in 6 days
I dare you to show your flag, I'm sure you're from some swamp in florida or something
Ethan White
>laughs at other people >implies 8k years of even selfselected evolution have a meaningful effect Someone doesn't know how words themselves developed.
Ayden Cruz
and my dad works at Nintendo
Sebastian Peterson
>genders describe biology >any non-breeding person is a defect >gender is real >property rights are real >why its subjectively something for humans to kill other animals
What you observe in nature does not necessitate a natural law. What you observe in nature is the current state of an eternally fluctuating range of experience. If you seek to use biology to dictate your understanding of human social structures, you're an autist and your beliefs will not be grounded in reality, no matter how good they make you feel.
Nathan White
If your posts cannot handle basic industry level inspection, you're probably larping.
Aiden Allen
>How do we know what bases correspond between the two species
Because we can look at them and see the similarities.
They do look "operational" alike.
Parker Myers
There are giant gaps in the RNA sequences. The "similarities" are artifical. They don't exist in reality.
Oliver Powell
I doubt you actually showed my post to a genetic engineer. If you did then he probably is at the bottom of his class.
Camden Martin
>Sup Forums >knowing anything about genetics except autistic haplogroup masturbation
I love how this article doesn't mention that the comparison is based on guessing. The gaps inbetween the species are actually many and the sequences only become similar because geneticists fill in these gaps according to their own bias.
This basically means that the computer fills in the gaps and call it "a match". What's so flawed about this is that you have billions of gaps that arbitrarily confirm what the geneticists think is the right combination of DNA alignments.
In other words: there is no actual proof for the claim that humans and apes are related genetically. It's mainly random filling of the gaps.