One of the most overexposed factoids in modern science is our genetic similarity to the African apes, the chimpanzees and gorillas. But how do we know just how genetically similar we are to them? What is that estimate based on?
Comparisons of DNA sequence ignore qualitative differences, those of kind rather than amount. To take the smallest case, consider a different sequence of twenty DNA bases from the same region: CCTTGGGCCTCCCGCCAGGC in the baboon and CCTTGGGCTCCCGCCAGGCC in the orangutan. If you stack them, one above the other, and compare the sequences you'll notice that they actually differ substantially. Molecules have complex ways of generating insertions and deletions in DNA, which we are only beginning to understand. For example, a stretch of DNA from a ribosomal RNA gene is forty bases long in humans and fifty four bases long in orangutans. The sequences on either side match up perfectly. How do we know what bases correspond between the two species, how do we decide how many substitutions have occurred, when obviously some have been inserted and deleted as well? While we might choose the alignment with the smallest numbers of mutational events, we still have to decide whether a gap “equals” a substitution, or whether a gap should be considered rarer and, therefore, worth, say, five substitutions. The problem is that we cannot tell which DNA sequence alignment is right. Another misleading area of DNA sequence comparisons entails a consideration of the other end of the scale. The structure of DNA is built up of four simple subunits: adenine, guanine, cytosine, and thymine, or A, G, C, and T. Since genetic information is composed of DNA sequences, and there are only four elements to each DNA sequence, it follows that two DNA sequences can differ, on the average, by no more than 25 percent and this creates a statistical oddity.
If you believe humans and apes are similar you are a moron.
>Molecules have complex ways of generating insertions and deletions in DNA, which we are only beginning to understand. >can't into epigenetics or proteomics Nigger confirmed.
Zachary Nguyen
Low is bait
Jayden James
>guise, if I conflate 40 human DNA bases with 54 orangutan DNA bases maybe I can prove we are the same
Intellectual dishonesty at its finest.
Kayden Sanchez
How is it bait? Genetically there is no similarity between humans and apes. Only confirmation biased "geneticist" claim there is.
Anthony Thompson
Wouldnt that only apply to the evolution of humans and not evolution as a whole? Are you trying to say that God created everything as it is and living organisms dont change over time or that we are ancient alliums?
I like the later better.
Easton Taylor
Our common ancestor is an Ape, so are chimps and gorillas, and if you go far enough you'll find one of our earliest mammalian ancestors
As far as I know they compare groups of genes, not sequences of aminoacids themselves. >If you believe humans and apes are similar you are a moron. Not really, information for basic structures like heart,eyes, eben brain is included in DNA, even if they differ between our species, some of it's information is repeated given how complex those tools are. we share a lot of common traits with apes, you could bring better example of human and banana sharing about 50% of DNA groups, that'd be way harder to defend.
Kevin Bennett
>proxyfag >memeflag nigger no one even mentioned atheism
Caleb Perry
Like I wrote earlier it is intellectually dishonest to compare 40 human DNA bases with 54 orangutan DNA bases. This means you have to shoehorn data in order to prove there is any similarity at all.
As for the traits you talk about it means practically nothing. Humans walk on two legs and so do apes, bears, birds and even dogs can do that.
Jacob Moore
>one of the rules of natural selection is no genetic drift
natural selection doesn't work in nature due to random genetic mutations, migrations and genetic drift. No shit a laboratory controlled experiment over a short period of time didnt encourage speciation, that's not news
Jose Bailey
Then you can't argue that Darwins finches experienced speciation.
Dylan Davis
It is not dishonest, if 20 of 40 bases of human DNA are close to similar with 20 out of 54 orangutan bases you have al ittle bit of a match. That's just a way to describe how close we are.
>As for the traits you talk about it means practically nothing. Humans walk on two legs and so do apes, bears, birds and even dogs can do that.
Now I know you're a brainlet. In order to have eyes your body has to conduct certain set of chemical and physical transformations when you're in your mother's womb, 'fetus knows' that because instruction how to build eyes is written in DNA,it's sequence which describes production of each one of our bodyparts. Chimps have a lot of similarities to humans eyes,brain,muscles,heart,livers etc. so we naturally will share at least part of instruction how to build it.
Easton Martinez
i'm not 100% on evolution because it remains a theory and all that but it really makes a lot of sense. It kind of explains everything, and the questions that it poses itself are smaller in scope than those that exist without it.
Because without evolution we are back to 'god created it' when trying to explain the origin of life.
Ryder Perry
You said traits, not biological processes. Trait is usually something external when you talk about appearence you dumb Slav.
And yes, it is intellectually dishonest because it's all guesswork. There is no real data available and therefore geneticists assume certain DNA bases correspond with other ones.
Isaiah Hill
Evolution was created by occultists to brainwash the masses and take out religion so that everyone would follow whoever is the strongest ruler, In this case Satanists. Science has always been about power i.e. magick and its uses for control and conquering. All scientific discoveries of the 21st century have been aimed at destroying the current culture. Look up the Black cube.... TV, Xbox, Smart Phones, Computer etc... all created to enslave the minds of the masses so that the elites can reign unopposed.
Jace Ortiz
>And yes, it is intellectually dishonest because it's all guesswork. There is no real data available and therefore geneticists assume certain DNA bases correspond with other ones. It's not a guesswork,they use mathematical ways of estimating closeness of two chains of aminoacids. and yes there is data, you just need to know how to look for it dumb cunt academic.oup.com/mbe/article/10/3/512/1016366
>You said traits, not biological processes. Trait is usually something external when you talk about appearence you dumb Slav Maybe I used wrong word. But again I'd call it a fucking scum if we didn't share most of our DNA with monkeys, it'd be crime against logic.
Angel Flores
>(((They)))
stop believing what (((they))) say. Start doing your own experiments or you're just a blind follower of another persons words and deceptions.
Alexander Brooks
I do, I thought it through numerous times and evolution seems to be the most logical outcome. The funny thing is that evolution can easily fuel white pride and nationalistic movement, but still some of us doubt it.
Austin Smith
>mathematical way of estimating closeness
Did you even read what you just wrote? To estimate means to assume. You form your entire opinion on loose formulas that have no actual value other than guessing.
To claim this is accurate is like saying that you can count the amounts of cells in the entire human body of one person.
Evan Rogers
Yes. We all originated from the magic man in the sky.
Isaac Fisher
You have have you, Then can you tell me What is Evolution? Is it a life force, an energy, a God?
Dylan Ward
>To estimate means to assume No you literal brainlet it means estimate means to measure with some level of doubt. That's what they did in scientific work I linked, it's free, all you have to do is click PDF sign and read a little. Will do you some good you dumb cunt. >To claim this is accurate is like saying that you can count the amounts of cells in the entire human body of one person.
Nobody does that, yet we can estimate it in many ways, you can get mean value of body cells per kg,or mean value of body cells per specific tissue like muscle or fat and ESTIMATE it even better. Dumb fucking cunt.
It's never ending cycle of fucking.
Brayden Roberts
>brainlet cant into transcriptome, proteome and metabolome >brainlet cant into gene homologs, paralogs and orthologs >brainlet cant into epigenetics, metagenomics, systems biology, RNomics >comparison of a few dozen nucleotides even though he obviously knows hominid sequence is gigantic
Jayden Jenkins
Estimation is literally guessing. You don't measure the speed of light, you estimate the speed of light.
Why? where does it come from, and what is IT? think about it, If evolution is real then it must be a type of external force that has high levels of intelligence and information.
Landon Watson
Darwins finches were spread on an archipelago and free to travel
Nicholas Campbell
>hominid sequence is gigantic
...and yet comparing a few nucleotide sequences is what makes current geneticist sure that we are similar to apes.
How's that cognitive dissonance working out for you, my euphoric fedora friend?
Aaron Lee
You don't estimate the speed of light. You calculate with ever decrrasing deviation. Its a fucking universal constant.
Jaxon Wood
>If evolution is real then it must be a type of external force that has high levels of intelligence and information.
It does not mean that. It doesn't even imply that. Explain this chain of thought to me please.
Michael Morris
Fucking 'science' plebs love to say how Ape and Man are 99% the same in terms of DNA.
Science plebs don't realize they've been touting that "We don't know what 99% of our DNA is" for the last half century.
There is no such thing as Macroevolution. Taking the humanoid model, in example.. it would be im-fucking-possible for the human to develop structurally in every way in the amount of time that it did according to the current timeline. There's something like a 150k year span in which our rib cages reversed, arms shortened 15%, bone density almost halved, and our pelvic bones shrank in size and density at an astounding amount. It's just not fucking possible. That amount of change would require many, many hundreds of millions of years to achieve.
Microevolution is totally possible. Sure, a bird can develop a sharper beak to peck through wood if their only source of food is within that tree, but it's not going to double it's bone density and muscle mass in 100 years so it can use it's origional beak to brute force it's way through said tree.
Modern "Science" is a scam.
Jonathan Gutierrez
So? The finches that Darwin observed are so ill-defined when talking about what species they belong to. If you believe that speciation is caused by natural selection then tiny, imperceptible differences in beak shape are the difference between survival and extinction. But since the finches can mate with each other, they can't be different species.
Evan Harris
>and yet comparing a few nucleotide sequences is what makes current geneticist sure that we are similar to apes. No it doesn't, you flat out liar. We compare millions of nucleotides at a time. After assembling the reads from sequencing you still have to annotate the entire genome as well as identify the transcriptome. Thousands of reads overlap to map a small gene. You compare both the DNA sequence and the translated aminoacid sequence against global databases to gauge similarity of function or homology. Try using the CLG Genomics Workbench with the DNA of something easy. Try E. coli, only a few thousand bases.
Caleb Bennett
>Estimation(orestimating) is the process of finding anestimate, orapproximation, which is a value that is usable for some purpose even if input data may be incomplete,uncertain, orunstable.
>even if input data may be incomplete, uncertain or unstable
And this is not guesswork because....?
Nolan Johnson
Consciousness can not come into being from matter. Reason, Logic, Language, Code, Mathematics etc... cannot exist in an evolutionary world because evolution is "seen" as only material. This is why Evolution is a myth.
Nathaniel Gutierrez
You're confusing Lamarckian 'evolution' with Neo Darwinism. Bottleneck effects on a population can indeed have drastic effect on selection.
Tigers and lions can mate yet are different species. Same is true for dogs and wolves. For zebras and horses.
Tyler Davis
Untestable statements are non scientific. You cant say your belief in the divine disproves all science.
Josiah Ramirez
Because you don't guess anything. Based on some data you're trying to deduce some other information. Guessing - 'Well I think speed of light is about 3210km/s because why the fuck not' Estimating - "Based on number of experiments I say speed of light is X, given that, future observations might improve this estimation". Estimation is part and parcel of science and it is not guessing.
We actually don't know if consciousness can not come into being from matter. Truth is we cannot do that, but we can't say it's impossible either. There is theory that Consciousness was developed from what we call instincts in animal case. Considering that those instincts were succesful, under years of benefiting from it, group of beings could develop it to such advanced point ,we'd finally have to call it conscience. Do animals have conscience according to you ?
Lincoln Collins
>compare millions
Yeah, by computer models. That means (spoiler) that you guess.
genome.gov/11509542/comparative-genomics-fact-sheet/ >Comparative genomics is an exciting field of biological research in which researchers use a variety of tools, including computer-based analysis, to compare the complete genome sequences of different species.
In other words: it's heuristic.
Joseph Sullivan
No you won't, faggot. The fossil record doesn't support it, it's all imaginary. That missing link still hasn't been found
Jacob Morgan
>Tigers and lions can mate
So you admit that there are no actual species and that the whole concept of natural selection is retarded? Good!
Grayson Phillips
>Yeah, by computer models. That means (spoiler) that you guess.
Processing data is not guessing.
>In other words: it's heuristic.
Bitch I wrote heuristics, there's literally nothing wrong with getting output from a well written heuristic.
Leo Ramirez
>I don't understand how natural selection works The purpose of natural selection is not to make the ultimate species or even make new species, these are possible consequences of evolution but not the goal. The end goal of evolution is simply to make an organism survive and reproduce as long as possible in its current environment. No more no less
Ian Allen
You cannot explain Consciousness, Information, Math, Music, Code, Logic, Reason, Beauty, Metaphysical concepts, Philosophy, Order, Architecture, Law etc... in a merely material world. To deny the reality of an divine dimension is intellectual suicide.
Ian Gutierrez
Newsflash, kid. All empirical human knowledge is gathered through observation and statistical analysis. This does not apply exclusively to science. It does no good to try to explain to you how biology works since you have a 15 year old grasp on nature. Its like trying to teach a nigger how reactive ion etching works.
Adam Stewart
Er...the fossil record quite clearly maps human evolution. That 'missing link' was found in 2010
Jace Howard
No, its you who are retarded and think mating cant occur in interspecies encounters and I gave you three real examples that blew you TFO.
Nathan Gomez
Post it
Carter Parker
It's not my fault that science disproves natural selection as backpedaling arbitrary nonsense. Tip your fedora harder.
Liam Mitchell
Theoretical science is always kike lies. Their proof for the evolution is a ton of fraud.
No one is denying any of that. The origin of consciousness and knowledge is a completely different matter. Talking about your personal beliefs does not give you argumentative power.
Connor Long
lol oh man OP is too much of a brainlet to understand the first thing about multiple alignment or homology testing
Adrian Miller
You actually can. I know that people like to think of higher art as something unreachable but mere animals know concept of aesthetics, there are birds that mate only with partners who made aestethically pleasing nests. Music - again birds love it. Logic, ravens are proven to use logic to solve simple problems. I can multiply examples. We're not special.
Owen Young
Science hasn't disproved it though. Infact nothing you have posted disproves evolution. You've taken information and due to your own lack of scientific literacy extrapolated and came here to scream and shriek at us simply because you don't understand what you're reading
Eli Anderson
stop posting that worthless cunt already
Carson Wood
>We actually don't know if consciousness can not come into being from matter.
Yes we do. People for thousands of years have known this. It has nothing to do with science and everything to do with philosophy. Science can only look at the material world, It cannot touch in any way the nonmaterial world of thoughts, concepts and spirit. If it tries it is no longer science. Consciousness is the spirit in a living being, animals have a degree of consciousness but it is different than a humans. Humans are not animals simply because their level of spirit is different, the same as a plant is not an animal.
Camden Jackson
>It's not my fault that science disproves natural selection It doesn't, though. You're just an idiot.
Then it should be easy for you to disprove and deal a huge blow to the scientific community. Go ahead, report your findings and go for that Nobel. Don't let your genius go to waste on an a Taiwanese arrow fletching board.
Evan Thomas
No? You admitted exactly to what the study regarding walking sticks proved: speciation can't occur in the wild if you carry genes back and forth between population groups.
Natural selection is invalid.
Leo Campbell
>he declared that the idea thatH. naledimight represent a linear link to modern humans wouldn't "survive scientific review." LOL
Dominic Johnson
>Math apes and chimps can learn math >Code More math >Music Some animals actually can learn to use instruments and they recognize music >Logic and reason Animals learn and problem solve literally all the time. Birds learn how traffic works in the city and use them to crack their nuts open >Law >Implying animals don't have social hierarchy Christ imagine being this retarded >Architecture Beavers build dams >Metaphysical concepts This is the only one that we can't observe animals doing. You get 1 point
Eli Peterson
>Stopped responding to arguments >couldn't get through elementary science terms >kek butthurt You're brainlet or underaged, go away cunt
People believed for thousands years that earth is flat , so I wouldn't use 'people for thousands...' as an argument. I can clearly see you're heavily distinctive towards material and spiritual world ,now what if we can translate all things you consider spiritual into material world ? What if simple chemical reactions are what you consider spiritual world ?
Lucas Wood
Evolution cannot explain these things because it is limited to the material world, Therefore these things come from an other source, that source can be no other than God, the supreme being from which all things flow. That is an indisputable fact if you use logic and reason as we were designed to do. What is disputable however is Who this God is. That answer can only be answered by faith.
Dominic Diaz
Err... yeah, no one in science thinks evolution is linear. It's a branching model. Did you take third grade biology?
Cameron Hall
>In 2017, however, the fossils were dated to between 335,000 and 236,000 years ago, long after much larger-brained and more modern-looking hominins had appeared.[1][4]The research team therefore thinks thatH. nalediis not a direct ancestor ofmodern humans, although it is probably an offshoot within the genusHomo.[5]
Eli Williams
>Homology
Forelimbs develop from different body segments in different species. Your argument has zero validity.
Jack Ward
>Animals have a degree of consciousness
Yes, but where does this come from. Not evolution as the Occultists would have you believe.
Charles Hill
I know how it works dumbass. If it's not a direct ancestor then it isn't the missing link
Nathan James
...
Brayden Jackson
Yes, All living things have a degree of concisousness. This is evidence against eblution.
Luke Cooper
Just look at gyppos and tell me those humanoids aren't something in between humans and apes, or more precisely - degenerated remnant of these species
David Reyes
Why wouldn't it ? If consciousness benefits one in some way ,it will be favoured in mating and will prevail.
Josiah Ward
If you knew how it worked you wouldn't actually be asking for a 'missing link' since that's not how it works. When people go "men came from apes" it isn't literal, what actually happened is that both humans and simians descended from the same ancient species. Making us in a manner of speaking, related. Like cousins if you want to think of it like that. This is still a simplified version though. Evolution is in no capacity a straight line. So there isn't a missing link. However, of the fossils we have found we can see a clear and undeniable relation between our species. Can you wrap your head around that or is the concept too complex for you?
Matthew Hill
In no capacity is it evidence against evolution
Owen Morris
Chemicals are matter. Thoughts are not. You have mixed the two dimensions in order to fit into your materialistic worldview, this only leads to intellectual suicide when you realize that everything is hollow and meaningless
Joseph Carter
That's what the missing link is, dumbass. The common ancestor. Not found, doesn't exist. I know the current theory and I've seen the evolutionary tree at museums and stuff. When you trace human lineage linearly it never goes beyond a point where they weren't humans. That's the missing link. No fossil of the common ancestor.
Jaxson Russell
>t's not my fault that science disproves natural selection That doesn't even make sense. Natural selection is something we have observed occurring in the world around us. It's not a theory. It's a description, a label for an observed reality. And natural selection occurs in a LOT of complex heditary systems, not just the evolution of biological organisms.
Carson Diaz
Every single adaption and change which you were told was from eblution is done by conscious free beings, not some vague force or energy.
consciousness is nonmaterial so where does it come from.
Nicholas Reyes
the common ancestor of any particular evolutionary family tree is ONE individual. It's not really terribly surprising one can't find that specific individual. However we have a pretty tight chain of ancestry establishing how ancestral species differentiated into us and our "close cousin" species (including a few that no longer exist).
Gavin Garcia
Yes it is. Evolution can not account for an immaterial state of being existing
Jackson Myers
> evolution is a vague force or energy No... it's inevitable the result of processes we observe happening in the world around us. Primarily (but not exclusively) natural selection, mutation and interbreeding.
Nathan Flores
It's one individual of a species that we don't know of. All you'd need is the fossils of the species
Brandon Robinson
Thoughts are little pieces of current going between synapses in our minds, they're very material. Not necessarily. Subconcious choices were told to be more important in choice of a partner, even if woman doesn't admitt it she looks for traits of alpha male. Males subconciously look for women with broad hips and big breasts for same reasons, we're driven by lessons evolution has given us.
Oliver Reyes
>Evolution can not account for an immaterial state of being existing I dont know of anyone who seriously argues that Evolution provides evidence for why things exist at all. It's just an explanation of how organisms change from generation to generation in the same lineage.
Jose Flores
Ok find another example of a bottleneck that caused a drastic almost 90% change in every facet of a living creature in less than 500k years.
It doesn't exist.
Mason James
That's not at all how this works, but ok Here's another link in the chain
What arguments? Evolution is so flawed and based on conflation. Is is laughable.
In fish and amphibia the kidney is derived directly from an embryonic organ known as the mesonephros, while in reptiles and mammals the mesonephros degenerates towards the end of embryonic life and plays no role in the formation of the adult kidney, which is formed instead from a discrete spherical mass of mesodermal tissue, the metanephros, which develops quite independently from the mesonephros.
Darwin was a full blown moron.
Robert Reed
What causes these processes and can evlution be seen, touched, felt, tasted, where is it now? where did it come from? is it a god or a life force, if not, then who created it? why does it exist at all?
Luke Long
We have fossils of hundreds of species and subspecies demonstrating the chains. But there'll always be someone saying "but what about between *these* two examples?". It's actually really rare for an organism to fossilize. What we have is an amazingly detailed and comprehensive record considering just how rare those fossils are.
Zachary Roberts
>That's not how that works, but here is what you're looking for What that so hard?
Juan Hall
Evolution can literally be observed, yes. >What causes it Well you see, when you take a species and put it in a hostile environment. The week ones die off and the strong ones survive to make cummies and pass on their genes. So because they are able to survive and reproduce, their traits pass on and the weaker ones are dead so they can't. And the next generation has these traits that lets them survive better in the environment. And this happens over generations. This is called evolution. It's very simple actually
Jacob Gutierrez
You provided no counter arguments to neither mine or portugal guy's statements, you just throw statements without providing source or arguments, you're a fucking idiot kiddo. Or you're just here to waste our time and you're too stupid to realize that those whom you're arguing with are extremely way intelligent than you.
Jaxon Thomas
He has no argument. He doesn't understand the subject
