One of the most overexposed factoids in modern science is our genetic similarity to the African apes, the chimpanzees and gorillas. But how do we know just how genetically similar we are to them? What is that estimate based on?
Comparisons of DNA sequence ignore qualitative differences, those of kind rather than amount. To take the smallest case, consider a different sequence of twenty DNA bases from the same region: CCTTGGGCCTCCCGCCAGGC in the baboon and CCTTGGGCTCCCGCCAGGCC in the orangutan. If you stack them, one above the other, and compare the sequences you'll notice that they actually differ substantially. Molecules have complex ways of generating insertions and deletions in DNA, which we are only beginning to understand. For example, a stretch of DNA from a ribosomal RNA gene is forty bases long in humans and fifty four bases long in orangutans. The sequences on either side match up perfectly. How do we know what bases correspond between the two species, how do we decide how many substitutions have occurred, when obviously some have been inserted and deleted as well? While we might choose the alignment with the smallest numbers of mutational events, we still have to decide whether a gap “equals” a substitution, or whether a gap should be considered rarer and, therefore, worth, say, five substitutions. The problem is that we cannot tell which DNA sequence alignment is right.
Another misleading area of DNA sequence comparisons entails a consideration of the other end of the scale. The structure of DNA is built up of four simple subunits: adenine, guanine, cytosine, and thymine, or A, G, C, and T. Since genetic information is composed of DNA sequences, and there are only four elements to each DNA sequence, it follows that two DNA sequences can differ, on the average, by no more than 25 percent and this creates a statistical oddity.
If you believe humans and apes are similar you are a moron.
In fish and amphibia the kidney is derived directly from an embryonic organ known as the mesonephros, while in reptiles and mammals the mesonephros degenerates towards the end of embryonic life and plays no role in the formation of the adult kidney, which is formed instead from a discrete spherical mass of mesodermal tissue, the metanephros, which develops quite independently from the mesonephros.
Nicholas Wood
So you're sayin Hillary is reptilian?
Chase Cox
>Evolution is not verifiable and based on conflation >copypastas whole cloth from Jon Marks that has nothing to do with evolution brainlet confirmed.
SAGE
Jaxson Lewis
Organs that appear identical in different animals do not arise from the same site or group of cells of the embryo. If they don't develop from the same tissue then all animals can't be descended, genetically, from the same ancestors.
Lincoln Moore
>comparative microbiology >has nothing to do with evolution
Pic related is you.
Jace Parker
where in that passage is there a claim that invalidates evolutionary theory, moron? and why are you using a copypasta from a biologist's book that doesn't claim that evolution is not verifiable? sage
Jaxson Clark
So you think that by conflating 54 orangutan bases with 40 human ones you can prove we are genetically similar? That's called to shoehorn data, my euphoric friend.
Blake Reyes
>The problem is that we cannot tell which DNA sequence alignment is right. the fuck is this even supposed to mean, how much of biology does have to willingly dismiss before typing out such an absurd statement
Justin Smith
the only one conflating is you, moron. we share dna with every living thing on the planet. how does this in any way invalidate evolution? sage
Matthew Wright
No. You have no real evidence for humans being genetically descended from apes. Did you even reaf the first post?
There are gaps in the comparison. 40 human bases are not equivalent to 54 orangutan bases when you look at how many gaps there are in the genomes.
Joshua Mitchell
>humans being genetically descended from apes that's not how evolution works, moron. we don't have lines of descent from modern apes, we share a common ancestor. kys
Mason Davis
When you look at how the comparison is done then you can see that by trying to conflate the human genome with the orangutan genome you engage in a statistical guesswork procedure.
There is no proof. Only heuristic data.
Luke Walker
If we share.a common ancestor then we descend from them. Are you denying that humans, according to the theory of evolution, are evolved apes?
Ryder Russell
but you shouldn't be conflating the two there is no right or wrong genome there is the orangutan genome and the human genome evolution is not some direct line towards a goal the two creatures share a common ancestor they adapted and evolved to fit their niche. end of story. their genetic code should not be the exact same, if it was, that itself would be a major blow to the theory of evolution
Daniel Lopez
The existence of pseudogenes and paralogous genees are strong indicators of evolution or at least direct descent and spontaneous gene duplication being involved in the speciation process.
David Martin
>If we share.a common ancestor then we descend from them.
Justin Stewart
>we descend from them it's simply impossible that you are this stupid. we have no lines of descent from modern apes, only a common ancestor. same goes for apples and every other living thing on this planet. sage
Jaxson Myers
>two creatures share a common ancestor
That's where the lack of proof comes in. If you compare the genomes, although the difference is huge in terms of gaps, you still have nothing. DNA and mtDNA also change at different rates and if you compare those too then you're basically just guessing.
You have to conflate several processes in order for the theory to make sense.
Isaiah Murphy
Don't worry, OP. "Biological evolution" is merely biological change over generations.
The simple fact that organisms can produce offspring that isn't exactly the same as their ancestors is proof that biological change happens over generations. So, whether you're looking at a baby that doesn't have the same color eyes as its parents, "seedless" crops that weren't "seedless" in the past, or "super" antibiotic-resistant strains of bacterial infections developing; these are all examples of biological evolution.
Seems you accidentally made an argument against the criteria used to determine genetic similarity rather than making an argument against biological evolution.
Samuel Cook
So by calling me retarded you convieniently disregard the fact that humans have different brains than apes, for example? According to current evolutionary theory humans and apes diverged, but humans were the ones that actually evolved while apes have maintained there primordial state of being with minor differences.
So by default, in line with evolutionary theory, we do descend from apes because they are the original proto-humans.
Joshua Morales
Hurr durr we all have a common ancestor but nobody knows what it is but everybody knows its there so lets just talk about some algae
Samuel Robinson
I was wondering when an adult would show up
Luke Hernandez
>So by default, in line with evolutionary theory, we do descend from apes because they are the original proto-humans. finding it difficult to believe you're not trolling at this point, but fuck it you seem to be very confused as to the basic premises of the theory of evolution and the evidence for it read the discovery of evolution by david young, it's not long and everything is very simply laid out and you can find darwin and wallace's publications and notes online for free, why not just read those?
Kayden Hernandez
See There is no proof for the claim that all animals are related because then there would be a similarity in terms of development.
Wyatt Turner
there is extensive fossil and genetic evidence at the micro and macro level modern medicine is based off the theory of evolution biology as a field is completely dependent on the theory read the fucking book, hell just pick up any biochemistry textbook, you clearly have done zero reading aside from clickbait blogs
Adam Walker
That’s so not true. Chimps and gorillas only recently evolved knucklewalking. Their post-split ancestors half walked on the ground or brachiated.
Bentley Ward
Paralogous genes occur because of duplications within the same species so that doesn't prove humans and apes are related.
Logan Moore
OP is possibly the biggest retard I've come across on this site
I'm not going to type out an argument because you're already ignoring and misinterpreting what others here are saying
saged
Henry Watson
>Their post-split ancestors half walked on the ground or brachiated.
How do you prove this other than by guessing? Are you assuming humans and apes developed similar features over time and by calling them similar or relted basically nullifies any distinction between them?
wits.ac.za/news/latest-news/general-news/2014/2014-08/taung-childs-skull-not-human-like.html >By subjecting the skull of the firstaustralopithdiscovered to the latest technologies in the Wits University Microfocus X-ray Computed Tomography (CT) facility, researchers are now casting doubt on theories thatAustralopithecus africanusshows the same cranial adaptations found in modern human infants and toddlers – in effect disproving current support for the idea that this early hominin shows infant brain development in the prefrontal region similar to that of modern humans.
Chase Cox
>genetic evidence
But if the tissue develops from different cells during the embryos growth then there is no actual genetic link between different animals.
Eli Williams
Nice ad hominem.
Luis Ortiz
>Same species >But members of a class or family can all have the same paralogous genes, indicating common descent
Logan Phillips
Look into convergent evolution. The potential and need existed, therefore successful mechanisms based on shared hereditary history and not direct descent actually proves the opposite of what your saying.
Jordan Price
yeah, you're right.
still the most plausible explanation i've heard
visually alone we are extremely similar to apes, if that's not indicative enough.. then fuck off
Josiah Stewart
>Saccharomyces cerevisiae (yeast), Arabidopsis thaliana (a weedlike flowering plant), Caenorhabditis elegans (a nematode), Drosophila melanogaster (the fruit fly), Mus musculus (the house mouse), and Homo sapiens (humans).
According to this flawed reasoning when comparing DNA bases, you only look at the tiny similarities in the gene code and disregard the huge differences that otherwise are present everywhere.
Nolan Russell
It doesn't really work like that. You can't claim we are all genetically similar and related when there is no genetic evidence for it.
Noah Morgan
>All of these animals share the same underlying structure in all the exact same places almost as if those are the important unchangable "how to work a cell" for that phyla.
Yes, I can and it does. If two different organisms share a common organ, the liver, but they make them completely different ways then that just proves they had the same ancestor at some point with the potential to develop a liver.
Benjamin Adams
>underlying structure
Read the first post. The gaps are more abundant than the similarities and since: >the structure of DNA is built up of four simple subunits: adenine, guanine, cytosine, and thymine, or A, G, C, and T. Since genetic information is composed of DNA sequences, and there are only four elements to each DNA sequence, it follows that two DNA sequences can differ, on the average, by no more than 25 percent and this creates a statistical oddity.
You literally have no actual proof.
>two different organisms share a common organ, the liver, but they make them completely different ways then that just proves they had the same ancestor at some point
This proves you don't understand homology.
Elijah Turner
>The gaps are more abundant than the similarities and since How much of the information on your computer is your OS? How many different programs do you think you have compared to some else, even for the same tasks? Does that change how exactly the same the HDD CPU GPU motherboard keyboard and mouse are to every model of that "species"? Just a note, computer code is written in binary, while DNA is a quadrary.
Most of DNA is size, shape, which parts are activated and which are dormant etc, we share much of the howtoo and blueprints with a large amount of the organisms of the planet.
>This proves you don't understand homology. >homology is the existence of shared ancestry between a pair of structures, or genes, in different taxa. en.wikipedia.org/wiki/Homology_(biology) Literally exactly what I said except its talking about confirmed genetic descent, which is not what we're talking about.
Eli Miller
Like I wrote: the differences outweigh the similarities. You basically have no real evidence except statistical oddities.
>confirmed genetic descent >which is not what we're talking about. So if the liver is produced from different cells during the embryos development then there is no actual genetic proof for the claim that all animals share a common ancestry.
Nice damage control, mister Wikipedia autist.
Camden Thompson
>differences outweigh the similarities Where did I claim this, please, point this out.
All I said was that we share common underlying structures and that the differences are modifiers to those cores.
>So if the liver is produced from different cells during the embryos development then there is no actual genetic proof for the claim that all animals share a common ancestry. Two groups animals have clumps of cells A and B after speciation. One animal modifies A into a liver, the other modifies B into the exact same liver. How does not make sense to you?
Parker Baker
>Where did I claim this,
You didn't, moron. I never said you did. Learn how to read.
>Two groups animals have clumps of cells A and B after speciation. One animal modifies A into a liver, the other modifies B into the exact same liver. How does not make sense to you?
You have a kindergarten tier understanding of homology. If you claim that genetic information proves that animals have the same ancestors then the embryological development should be identical.
Do you even know how genes work?
Angel Morgan
>You didn't, moron. I never said you did. I was saying where did I say the similarity outweigh the differences, lrn2context. My argument is specifically that the similarities are more important then the differences and the differences are modification data, not blueprint data.
>You have a kindergsrten tier understanding of homology. If you claim that genetic information proves that animals have the same ancestors then the ebryological development should be identical. No they wouldn't, why would they not continue to change?
>Do you even know how genes work? Teach me oh wise one.
Isaiah Thompson
So what you're saying is that there is no human race?
William King
So what's ur point user? The degree of your eagerness to dig up as much as you can, to find disqualifying minutia, to correct everyone and assert that evolution cannot work has me conviced that you are less likely to be arguing to understand and more likely to be arguing to push a point. So what is your point? Is it simply that evolution and natural processes could not have brought about the world and the universe around us? Are you proposing a new theory on how life and the universe came to be? Or are you simply waxing philosophically over every "gotcha" to gaslight and perhaps push for some "intelligent designer"? Or is it all about the ego and the thrill of the gotcha? Also, nice hiding of your flag. Are you on this Etruscan barrel weaving forum on a mission trip?
Joshua Gonzalez
>I was saying where did I say the similarity outweigh the differences, lrn2context.
No, you quoted my post with >differences outweigh the similarities. That means you said that I claimed you wrote this. Learn how to quote.
>My argument is specifically that the similarities are more important then the differences
That's called flawed reasoning. You basically ignore all the data that's overwhelmingly contradictory.
>No they wouldn't, why would they not continue to change? You can't trace an animals genetic lineage unless the genes remain the same. I don't understand your mental gymnastics.
You're saying that if you want to trace the genetic descent between different animals you need to compare different genes in the same cells.
Hunter Hill
Sigh >No, you quoted my post with >differences outweigh the similarities. That means you said that I claimed you wrote this. Learn how to quote. I quoted what you said and asked where I made a claim to contrary, though it was a slight bit unclear. But its obvious by how far your willing to take your artificial idiocy that its just a point of contention that you want to argue over to muddle the waters.
>You basically ignore all the data that's overwhelmingly contradictory. I'm not the one who's saying it doesn't matter that a organisms have alot of the same code in the same places. Or ignoring the fact that we know what most of what these things do, and can target specific similarities in other animals who share a close enough version for testing.
>You can't trace an animals genetic lineage unless the genes remain the same. I don't understand your mental gymnastics. What are you on about now? Are you saying we can't track the changes? I'm seriously starting to wonder how you breath.
>You're saying that if you want to trace the genetic descent between different animals you need to compare different genes in the same cells. No I'm not. I'm saying.....
Yea no, I'm done. No one is this dense, there is some alterior motive behind your argument and you aren't arguing in good faith.
Asher Ross
I am actually going to finish my last statement but not more.
I'm saying if you want to trace genetic descent you look at genes. I'm saying if you want to look at convergent evolution from non-genetic descent you just have to compare protein synthesis genes after phyla splits and the potentialities inherent in that system.
Camden Morris
>I quoted what you said and asked where I made a claim to contrary
You quoted a specific sentence and then asked where you claim you said this. That's hard to misinterpret.
>same code in the same places
There a lot of differences in the same places, you know.
>Are you saying we can't track the changes?
No, I'm saying that you don't seem to understand how homology works. If you want to compare embryological development between species and claim there is a genetic similarity, you conpare the stages of amino-acid formation. If they don't develop the same way they're not homologous.
>Yea no, I'm done You call me dense and yet you have a toddlers understanding of homology.
Thomas Perez
>If you claim that genetic information proves that animals have the same ancestors then the embryological development should be identical. that's absolutely false and demonstrates a fundamental minsunderstanding of development
Hudson Jenkins
stop (ironically) being a fucking monkey and believing whatever people tell you for the worst
Jaxon Johnson
>that's absolutely false and demonstrates a fundamental minsunderstanding of development why?
Liam Perez
ncbi.nlm.nih.gov/books/NBK10049/ >Homologousstructures are those organs whose underlying similarity arises from their being derived from a common ancestral structure.
>Nauplius larvae of (A) a barnacle (Tetraclita,seen in ventral view) and (B) a shrimp (Penaeus,seen in dorsal view). The shrimp and barnacle share a similar larval stage despite their radical divergence in later development. (AfterMüller 1864.)
They develop exactly the same at a embryological stage and are homologous. But when you compare other animals in their development this doesn't hold up.
