>it's a main suspect confesses to murder too early in the episode and everyone is happy with the case closed except for the skeptic main character episode
It's a main suspect confesses to murder too early in the episode and everyone is happy with the case closed except for...
>I don't know Mick, something just seems a little.. off... about this case.
but this is a comfy uncomfy feeling
>It's a the most obvious suspect did it episode
Motherfucking butler!
>its an olivia benson acts like you kicked her grandmother if you even suggest the suspect might be innocent episode
>It's a 'celebrity guest star was the criminal all along' episode
>it's a the most medium suspicious suspect did it episode
name 5 (F I V E) shows that has this
>it's a the only new character introduced in the episode is the secret bad guy episode
every supernatural episode tbqh
>it's a "ten hours ago" episode
Or worse
>it's a show that starts with a flash forward every goddamn episode
>the skeptic main character turns out to be wrong
>everyone else has a good time for the rest of the episode
>It's a boss of the main character doesn't trust main character with their methods despite the main character solving six entire seasons of crimes previously episode
Criminal Minds
NCIS
Law and Order
CSI
Person of Intrest
>It's a 'man is accused of murder/rape but it turns out a woman was responsible/faked it the whole time' episode
Love seeing Olivia's shocked expression at how a woman could possibly do such a thing
it's a department gets officially investigated for said methods by someone who had a previous beef with one of the main characters
>it's the suspect that makes absolutely no sense and can't be explained did it episode
House and Monk
>"I know who the killer is" "I know how to save the patient"
>"Don't be ridiculous"
>there's still 20 minutes left, there has to be more plot
>2 seasons later it turns out they were actually right
>Suspect is a probably a pedo but didn't commit the crime.
>Think your a big tough guy?
>Like raping little girls?
>WHY DON'T YOU TRY AND RAPE ME!
>it's a 'warrants are either quick and easy to obtain or incredibly arduous depending on how much time they need to fill in the episode' episode
It's a 'person goes down for a crime he didn't commit and the real killer confesses to the detectives knowing there's nothing they can do about it' episode
It's a "The detective was the serial killer he was looking for the entire series"
Fucking Adress Unknown
>it's a 'main character is taken off the case despite being literally the only detective that ever solves anything' episode
>and then she doubles down and still thinks he was guilty learning nothing from it
her being by herself only made this worse
Stabler: "Turns out the guy was innocent all along, Liv."
Benson: [pouting] "I still don't like him."
2018
cant wait
>it's a main character takes matters into his own hands despite it being illegal or immoral and he actually gets the job done episode
>and your other gun
*unzips clothing*
>"these?"
When has the butler ever done it?
The Aristocats.
> special character who is meant to be charismatic and important is finally introduced
> special guest star : shitty washed up Hollywood actor
>actor who wasn't famous 15 years ago shows up in episode 15 years ago
>turns out to be the killer anyway
>turns out there's no more main plot, it's just drama with the detective's family
Any examples of this? I'm genuinely interested
Primal Fear. Edward Norton kills it, and that was his debut. It's not exactly the same as described, but the nuance makes it even better.
>detectives staring at suspect from behind one-way mirror
>"What do you think?"
>"He doesn't have it in him. Burglary? Assault? Sure, but this guy's no killer. Just look at him. No, the guy we're looking for is a stone cold killer."
>detectives staring at suspect from behind one-way mirror
> suspect looks directly at man behind the mirror
>Cop goes rogue and captures the criminal, who somehow still goes to jail despite all the evidence the cop had against him being unlawfully attained and unusable in a court of law
The wire
>That Cocksucker McNulty
>police show
>chief of police is black
>gang related crime in black neighbourhood
>all black characters suddenly preoccupied while white ones search for witnesses
>hurr why don't they cooperate
>chief ignores obvious evidence and tells detective to stop investigating
>b-but..
>THAT'S AN ORDER!
>detective goes on to solve the case on their own
Beau Sejour
Now name the episodes.
>it's the victim actually killed himself to frame one of his enemies
>It's a "everything is fucked until the le-alternative-computer-womyn-haxor goes tik tik tik on her keyboard and suddenly has everything that the agents could ever need to save the day and wrap up the case" episode.
This is why I had to stop watching Criminal Minds. It was just too much.
>zoom in
*tick*
>enhance
*tack tack*
>can we get a clearer view?
*tick tack tack tick*
>so, the sequence past his hairline gene is AGGCCCTTACAAGTCATTGAGACTCGCAAA! send it to the lab
>The cannibal's name is Hannibal.
It's an Olivia Benson has a great rack but doesn't show it off episode
Every single one :(
>It's a stabler larps as a pedrofile to get a perp more comfortable, going into vile detail about what he wants to do to his own daughter
What were they thinking
Que