HAHAHAHAHHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA
>this is what christcucks worship
Checked. Christcucks btfo.
lol
Reminder that this image was created by Israeli jews
Bullshit, this is not Jesus-sama I pray to everyday
Jesus was a blonde/blue Nord and an incarnation of Balder.
You're wrong and this free book written by a Sup Forumsack explains why.
en.wikipedia.org
>Image on pithos sherd found at Kuntillet Ajrud below the inscription "Yahweh and his Asherah”
ibtimes.com
>You might know him as Yahweh, Allah or God. But on this fact, Jews, Muslims and Christians, the people of the great Abrahamic religions, are agreed: There is only one of Him, Stavrakopoulou wrote in a recent article. He is a solitary figure, a single, universal creator, not one God among many … or so we like to believe.
>The inscription is a petition for a blessing, Stavrakopoulou says. Crucially, the inscription asks for a blessing from 'Yahweh and his Asherah.' Here was evidence that presented Yahweh and Asherah as a divine pair. And now a handful of similar inscriptions have since been found, all of which help to strengthen the case that the God of the Bible once had a wife.
Jews amd Christians alike worship a pantsless, infertile one testicle god. How anyone take them seriously is beyond me.
Amerimutt Thread?
Looks like an average Christian to me.
cis.org
>Jewish organizations repeat the familiar mantras and continue with their uncritical "celebration" of diversity. (Diversity meaning, of course, diversity of race and ethnicity but not opinion.)
>we continue to mouth the traditional policy line affirming generous — really, unlimited — immigration and open borders
>our disproportionate political power (pound for pound the greatest of any ethnic/cultural group in America)
Your average, israel supporting "christian" american
I actually like Salah in this season
Nope just Christian. Most Christians aren’t even white lol.
HURR DURR ME LOVE JEBUS
Jesus loves you
You have no idea.
You idiot, it has pretty much been proven that Jesus didn't actually look like this. It was all speculation that he might of possibly looked like this then a bunch of edgy neo-pagans decided to ride the hating christian train along with everyone else.
>le 56% savior face
Watch out Christians, we have a level 80 Ninjitsu master here!
>sword has a cross
Wrong.
Jesus was white, of Greco-Roman lineage, who had a large diaspora in Galilee and Judea, frequently performing skilled labor (such as carpentry).
The philosophical precepts of the NT clearly draw from age-old European schools of thought rather than Jewish traditions.
Thinking Christianity or Christ was Jewish based on the geographical genesis of it is retard-tier and shows total ignorance in respect to the demographics of the Roman Empire. It is a simpleton argument based on nothing more than geographic location.
Pic related is a major redpill and will have you unironically undergo a "wtf, i love jesus now" shift.
Holy fuck im exiting chistianity right now if jesus was a nigger or brownie !!!
>Jews
>white
Atheists, Pagans, Faggots and blasphemers go to hell. Praise the Lord!
>implying I implied this
I said he was "white" which would preclude him being Jewish, no?
Regardless, it explicitly shows in the screen cap that he wasn't Jewish but merely tailored his message for a Jewish audience.
LMAOOOOOOOOOOOOOOOOOOOOOOOOOOO
>t. christcuck shills
Why are there so many of them all over Sup Forums all of a sudden?
...
>everyone who doesn't pray to a literal kike who looks like OP's pic is a fedora
Kill yourself, shill!
2018 and still retarded, amerifat.
He was. He was also a kike. A sand nigger kike.
EDGEEEEEEEE
...
Not christcuck, I realize that the NT is distinctly European and accept its contributions as a net positive for European civilization from it's inception until the early 1900s. After that point, as the years went by, it was water-downed, castrated, then finally and totally subverted to the pathetic modern state it is now in.
I established (here ) that he was not a kike and the ideology of the New Testament is clearly not of Jewish origins but rather European ones.
You are falling for the Jewish lie by believing Christianity is a Jewish product, which totally ignores the European philosophical currents that it builds on (Neopythagoreanism, stoicism, etc). The asceticism preached in the NT is not only alien to the OT, but contradictory to it.
If the latest science and genetics is true then this is what europeans looked like in the beginning:
Dumbass
13 And in the midst of the seven candlesticks one like unto the Son of man, clothed with a garment down to the foot, and girt about the paps with a golden girdle.
>14 His head and his hairs were white like wool, as white as snow; and his eyes were as a flame of fire;
15 And his feet like unto fine brass, as if they burned in a furnace; and his voice as the sound of many waters.
They weren't allowed to make poctures if God you retard. And no one has seen God the Father.
This thread is made every day by Soros shills. It's pathetic.
>Buttblasted that he worships a kike
Explain how a man who lived in sand nigger terroritory and was stated to be a jew was a jewish sand nigger
>sand nigger terroritory
Roman Empire which had a large diaspora of non-native residents from Europe especially employed in commerce, specialized labor and governance.
>was stated to be a jew
Not really. The only accounts that he was a Jew are thought to have been added in the Gospel of Matthew which was done to fulfill Jewish prophecies. The genealogy in Matthew and account of the birth in Bethlehem are regarded by scholars as dubious at best.
It is entirely possible he preached that he LARPed as a Jew simply because it would have been easier to win the locals over to what he was teaching.
>was a jewish sand nigger
No. See the screencap here: .
The fact that the earliest records of the NT were in Greek, the fact that the NT taught European ideas and thoughts, the fact that Jesus was employed in skilled labor, and that he was an ascetic who led an extremely similar life to Apollonius of Tyana, are all highly indicative that the NT is a European product and that Jesus himself likely was NOT Jewish.
Your argument is reductionist and based solely on geography and ignores the complexities of concurrent Roman Empire demographics and philosophical roots.
>They weren't allowed to make poctures if God
ibtimes.com
>Despite numerous references to Asherah worship in the Bible, there wasn't enough evidence to link her explicitly with the high god of ancient Israel, Yahweh. Until, that is, the discovery of a remarkable ceramic inscription in the Sinai desert.
>The biblical texts name many of them - El, Baal, Molek, Asherah. Despite Yahweh's assertion in the Ten Commandments that You shall have no other gods before me, it appears these gods were worshipped alongside Him, and the Bible acknowledges this.
Learn your Bible history, Jew hugging moron. Yahweh is one of many gods that Jews worshipped.
>ProjectLifeguard.net
>christian
>proceeds to put pictures of over-sexualized, vicious nude whores
SAD!
Actually, we all looked like monkeys if you want to go far enough back in time.
That "science and genetics" would have no idea of what "euopeans looked like" so long ago, btw.
One of the most overexposed factoids in modern science is our genetic similarity to the African apes, the chimpanzees and gorillas. But how do we know just how genetically similar we are to them? What is that estimate based on?
Comparisons of DNA sequence ignore qualitative differences, those of kind rather than amount. To take the smallest case, consider a different sequence of twenty DNA bases from the same region: CCTTGGGCCTCCCGCCAGGC in the baboon and CCTTGGGCTCCCGCCAGGCC in the orangutan. If you stack them, one above the other, and compare the sequences you'll notice that they actually differ substantially. Molecules have complex ways of generating insertions and deletions in DNA, which we are only beginning to understand. For example, a stretch of DNA from a ribosomal RNA gene is forty bases long in humans and fifty four bases long in orangutans. The sequences on either side match up perfectly. How do we know what bases correspond between the two species, how do we decide how many substitutions have occurred, when obviously some have been inserted and deleted as well? While we might choose the alignment with the smallest numbers of mutational events, we still have to decide whether a gap “equals” a substitution, or whether a gap should be considered rarer and, therefore, worth, say, five substitutions.
The problem is that we cannot tell which DNA sequence alignment is right. Another misleading area of DNA sequence comparisons entails a consideration of the other end of the scale. The structure of DNA is built up of four simple subunits: adenine, guanine, cytosine, and thymine, or A, G, C, and T. Since genetic information is composed of DNA sequences, and there are only four elements to each DNA sequence, it follows that two DNA sequences can differ, on the average, by no more than 25 percent and this creates a statistical oddity.
If you believe humans and apes are similar you are a moron.
>Jesus was white, of Greco-Roman lineage
In that case it could have not been the promised messiah, who is supposed to be a perfect jew.
Jesus was a drug dealer, he worked 7 days a week and the pharisees didnt like that but niggaz gotta b hustlin so he did it anyway. He hung om the cross for 3 days waiting for his amphetamine high to wear off, then he pretended to be dead by slowing his heartbeat. The homies busted him out and he gave everyone of his disciples a neighborhood to run before skipping town to medina, where he changed his name to muhammed and began plotting revenge against the kikes who set him up.
There's barely any evidence that any specific individual called "Jesus" as described in the bible existed in the first place. There's only really Josephus but that's widely considered suspect as a forgery.
We dont know if the biblical Jesus was a fictionalization of a real person, an amalgam of multiple real people, or a pure work of fiction.
Pinning down an ethnic group for the historical Jesus is pure speculation. Interesting and fun speculation perhaps, but still speculation.
Christianity is for trailertrash and niggers
nigga u have autism or u just under age?
>this is what edgy baiters on Sup Forums believe Jesus actually looked like
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA.
Two can play that game burger.
La Abominacion
To this day we still dont know whats he's capable off , but is well known that is extremely dangerous , probably capable of threatening humanity as we know it , every close encounter has resulted in the termination and consumption of the interviewer.
Further investigation must be done