You inbred liberal retards. GMO thread

Anyone who thinks GMOs are bad or should be banned is deliberately ignoring the scientific consensus on the issue.
Any point you conspiratards or crunchy yoga-moms bring up time and time again whether it's pseudo-scientific, economic, or political is 100% organic horseshit.

Other urls found in this thread:

articles.latimes.com/2011/feb/13/opinion/la-oe-guriansherman-seeds-20110213
twitter.com/NSFWRedditGif

>scientific consensus

You mean that same scientific consensus that swears up and down all races are identically equal and mankind is directly responsible for all climate change?

Fuck off nigger, I'm not eating fruit that has animal genes in it.

GMOs are bad.
They keep poor people in 3rd world countries from starving.
Instead of starving to death and fixing the problem they fuck more and have more babies they can't feed, therefore needing more GMOs.
It is a fact that GMOs are helping overpopulate the planet.

Good thing there is no fruit sold with animal genes, you dumb nigger.

Even if there was, why do you care that a gene says ACGATCATCGACGCCTACGATAC instead of CACTCAGCTAAATCGACTCAG

Who gives a fuck where it came from it isn't part of an animal.

i have celiac disease
but i can eat bread in paris
their wheat hasn't yet been ruined by gmos
think about that u cuckold

>Not understanding how birth rates work.

The most shit-filled nigger lands on Earth, Nigeria and India, are experiencing the biggest population booms in the world while at the same time dying before they're 40.

Increased life expectancy and decreased infant mortality slows population growth, basic shit.

Pic related

THERE IS NO SUCH THING AS GMO WHEAT YOU FUCKING RETARD OPEN A GOD DAMN BOOK

>$0.25 has been deposited in (((your))) account

If you eat bread in paris and didn't go to a hospital, you do not have celiac. It is a gluten allergy, not a GMO allergy.

Oh boy.

>scientific consensus on the issue

not allowed to have scientific consensus on the issue because GMOs are defined as "substantially equivalent" by people willing to suck lobbyist dick for "donations", so the modified organisms are more or less the same as unmodified organisms in the eyes of the "law".

>cant find H2O?
>just drink pure, refreshing H2O2
>its substantially equivalent to H2O
>only one extra oxygen atom
>it doesnt mean anything

> the biggest population booms in the world while at the same time dying before they're 40
>Increased life expectancy and decreased infant mortality slows population growth

So you basically just proved my point.
It's the shitty thirdworlders that keep having kids and the gmos help them do it.

Also keeps the cost of food in first world countries cheap enough we don't riot all the time.

The science of GMO's are good. The business of GMO's, namely that you can patent and monopolize the food people need to live, is fucking horrible.

Why

why not?

it's not the gmo part that is so bad. but the reason they make plants gmo is so they can handle the insane amount of round-up that they will be soaked in. normal plants would get stunted with that amount of herbicide.

Because you could patent plants since 1930, it's nothing new and is not exclusive to GMOs. There are thousands of nonGMO patented plants.

they use gmo as DRM

That's the point, roundup kills other plants, that's what it's meant to do.
And they aren't soaked in roundup, the concentrations are low because of how effective it is being a contact herbicide.

>Oh course since their populations keep growing we need to give them more and more food each time, Thus solving the problem once and for all.

Digital Rights Management?

Oh hey look, Malthus. The guy who predicted an exponential population growth ending in starvation that never actually happened because of reasons I said here
If they don't have to have 10 kids because 90% of them aren't gonna die, they will have less.

Science shows that races are different, what are you on about?

GMOs are good for first world countries

Even better for third worlds

You stupid niggers wouldnt even be able to eat corn or bananas without GMOs

Bananas aren't GMO and neither is any corn you've eaten that isn't in a cow, in corn syrup, or in corn starch.

the real problem with GMOs is that it allows jew corporations like Monsanto to have a monopoly over our food producers. Remember goyim, you're only allowed to buy our trademark kikeseeds, no replanting!

>scientific consensus
Doesnt mean much desu.
>pic
Thats shitties argument you could use on pol. Why anyone have to solve problems for niggers who are too dumb to either stop fuckin or start growing their own food.

I have celiac disease for real
I couldn't eat shit in Paris because all they sell is bread

India's fertility rate is barely above replacement and its life expectancy is over 70.

This is what a banana that wasn't ever modified looks like you daft cunt

It's hard, has seeds and tastes like shit

Just google it you dumb fuck

Or you could just buy something else if you don't want to sign the licensing agreement saying you won't replant them.

>What is GMO
There's a difference between selective breeding and GMO.
Just google it you dumb fuck.
"GMO" Read first definition.

India is huge and the fertility rate varies

pic related

The problem with gmos isn't really with genetic modification itself. The people who have a problem with genetic modification are just idiots.
These people. The problem is Monsanto represents gmo, and Monsanto is a shit company.

Its not just liberals who are against GMOs. Many conservatives are against it because it allows humans to play God, to alter God's creations in bizarre ways.

No, you are allowed to buy whatever else you want and replant that.

You are not allowed to sign a contract that says you will only use their seeds for one season and then find a way to extend beyond that by copying the seeds by producing seed stock just like you can't borrow a book at the library and photocopy it to sell and cry free speech later.

Don't like using things once, buy something else.

Well they're even more retarded

If it's genetic structure is modified it's a GMO you bumfucking cunthead, selective breeding and stenting are processes of genetic selectic and modification

Man you're a dumb fucker

In what way exactly

You drooling spaz. Genetically modified doesn't mean selectively bred.

I hate to tell you this but climate change is anthronpogenic and if you think otherwise you are literally ignorant.

You have a good point about race though.

Yes, you could say it is "genetically modified" but GMO specifically refers to transgenics.
pic related

Pretty much this.

I've got no problem with GMOs, I do however have a problem with our IP laws, especially relating to them.

And an even bigger problem with us trying to shove those laws down everybody's throat with "trade" deals and giving IP laden """"aid"""" to countries that turns their farmers into slaves while useful idiots jerk off about how they're helping.

You have being a pussy disease. Nobody complained about bread being too hard for poor widdle Tommy's tum tum 50 years ago, faggot

You know genetic engineering doesn't just encompass altering the transcription of a genome using PCR and shit like that right?

The government price floor strategy is more a part of that than anything. Food stamps are part of that. Paying for poor people to eat for free helps make sure that an ample harvest is never worthless, for instance.

It's amusing how global cooling and global warming never eventuated as predicted so the carbon credit trading kikes now use the catch all term climate change. The climate has been changing long before we came along. The kikes however, never change.

Why is that bad

You underestimate the ability of niggers and trash to fuck

It is all they know how to do and they do it well

Anyone who thinks there's literally no problems with GMO is easily fooled by big money corporations and propaganda.

Ironically, the same people who think GMO's are just fine, are also the same kind of people who think global warming is a hoax.

You're so easy to manipulate, every big industry does it.

Genetic engineering isn't selective breeding and stenting.

Do I have to post another screenshot from google or are you going to look up the definition yourself?

Genetic engineering is when you manipulate DNA directly through a variety of methods, but the key part is that it is targeted and specific.

Conventional breeding, hybridization, and mutagenesis are not GMO.

GMOs are shit and anthropogenic global warming is a kike scheme to tax the air we breathe.

Fight me, cunt

It is global warming because more energy from the sun is being trapped than is released

The energy is mostly stored as ocean warmth. Because of ocean currents however, it means that weather patterns become more pronounced instead of being always warmer

But calling it global warming was misleading to dumbfucks like you who thought it was very simple. Some areas ofvthe ocean, like the North Atlantic, have seen a decrease in average temperature.

No, I don't want to buy any of your carbon credits, Schlomo. Fuck off.

Has its genome been altered?
Is it an organism?

Checkmate

That moment u join a thread that seems to have a good scientific topic to discuss then out of nowhere people say: well faggot everyone who disagree is a liberaltard? It's a well known fact that gmo corps are under pro longed studies not duo to its impact on humans but on nature and it long term effects on humans! Please read the fucking reports about it before u blast liberal Democrats for not beliving in gmo this early on in its creation.


Nature as in the balanced system of ecologic system

You sound like one of those dumb enlightened people that are really enchanted by science as if it's magic

ITT: People who believe GMOs are bad despite having no evidence

It's simple to explain the liberal mindset on the subject of GMO ; human beings naturally fear that which they do not understand.

Seems a repetitive lesson.

Once you understand that without GMO, we would either need to clear-cut a ridiculous amount of forest to accommodate natural plants, or simply let a large portion of the population starve, you start to accept GMO food.

I don't fear GMO foods, but I'm cautious enough to ask what forms of safeguards we're employing to ensure against a high yield mistake that might cause us to be set back too many fields of crops for a year.

Ultimately, the real problem is : we have too many mouths to feed naturally, so we have to do it un-naturally. We either embrace manmade everything, or we reduce the number of people.

I'm finding it increasingly difficult to know which is the ethical choice.

At least read the thread

>Monsanto Shills

The thread is literally just people saying "it's the kikes!" and then arguing about what a GMO is

i have a similar case sort of. 5 years ago my doctor told me i had celiacs so i stopped eating wheat. at a family reunion my aunt always bakes me a few cookies with rice batter instead of wheat, well she tricked me into trying organic wheat and i didn't have any attacks or stomach pangs. apparently wheat has 3x more gluten protein in gmo version? no fucking clue whats going on with this food now a days but i try to stick to non edited stuff when it comes to breads, they're so much more chewy and filling too. i'll probably get anally raped with replies by shills but just trying to share what's happened to me.

It doesn't work like that. It has an actual definition.

Every single crop in human history is just as unnatural as GMOs. How will introducing GMOs have any impact on the environment that thousands of years of other unnatural plants would not?

>Not arguing against my claims but instead dismissing them as paid for

There is literally no GMO wheat. It has never been sold.

$00.03 x 21 has been deposited to your account for a total of $00.63
Thank you.

Everyone is so anti GMO and I'm just sitting here like where are the 6 legged chickens.

$.03? Wow, look at Mr. Fatcat over here.

It's $.02 with an hourly cap of $.50

Here in India I can afford my own personal shitting street with that wage.

>Monsanto BTFO on the last GMO thread
>their paid shills are back for more

the only issue with GMO food is intellectual property trolling of farmers

Which never actually happens.

google "monsanto paying online trolls"

nuff said

Or instead consider the notion that there are some people who give a shit about science literacy and enjoy debating with people, even on Laotian carpet weaving forums where you get called a shill.

or get a real job instead of shilling for monsanto

>dietary advice from an American
I would maybe take it into consideration if you weren't morbidly obese and diabetic.

>You mean that same scientific consensus that swears up and down all races are identically equal
It doesn't. SCIENCE says otherwise, but non-scientists suppress the information. Some """scientists""", also known as anthropologists, generally do claim otherwise. But they're cucks and anthropology is a soft science, bordering on pseudoscience because of the people who practice it.

>and mankind is directly responsible for all climate change?
This isn't the scientific consensus. Just like how genetic determinism contributes to the majority of difference in races, humans contribute to the majority of difference in climate change, but not all of it.

I do! I'm a construction worker.

This is exactly how leftists argue

they aren't interested in discussing policy or politics

they attack who you are using character attacks so they can dodge any discussion at all.

Are you so autistic you can't defend your own argument?

I don't mind eating GMOs but I don't see whats wrong with knowing if something is GMO or not

It's the exact same logic as

>YOU'RE A FUCKING WHITE MALE

There's tons of scientific controversy on climate change.

GMOs on the other hand have had tons of opposing scientific investigations because people really want to prove they're bad. Proving GMOs have negative health implications would make a person very wealthy. However, it's very difficult to find any such study.

Also, even the idea of GMOs isn't really that alien. We've been genetically modifying things ever since we knew how to crossbreed plants. It's just now we are controlling it more.

i dont argue with shills

my opinion on GMOs is "feed it to niggers in africa not Americans"

>i dont argue with shills
AKA
>I have an opinion and won't ever learn to argue it or defend it against scrutiny

I don't know what to think on GMOs. It's too broad of a term.

Any good facts and specifics anyone can link me to. I want to be persuaded to take a position, but I don't see any reason why or why not.

aka i dont compromise with my enemy and want to see them crushed into dust

*unsheaths kitana*

Soylent does a pretty good job summing it up on their blog.

blog.soylent.com/post/148000076992/proudly-made-with-gmos?utm_source=Soylent.com+Newsletter+%5BENG%5D&utm_campaign=c4f89307d5-7_28_16_pro_GMO&utm_medium=email&utm_term=0_0d56fc2b3d-c4f89307d5-70027209

I think tumblr is more of your style

they like it when no one disagrees with them so whenever they have an opinion, it's never challenged.

*tips fedora

GMO's are great. Monsanto however is a greedy corporation that has no intention of actually sharing the GMO food they grow.

>Pretty much this.
>I've got no problem with GMOs, I do however have a problem with our IP laws, especially relating to them.

It's two part, contract law and property law.

They own the change they made to the organism. That's their own invention and they own it. I think that's reasonable so long as that ownership will pass into the public in a reasonable time.

The second part is contract law in which they limit the ability of the farmers buying their product to be used in only a way they allow. I'm a bit mixed on this. I wouldn't buy a computer that I could only use in a way approved by the manufacturer, and I wouldn't feel bad about breaking any protections they placed on it. If I bought a product and even if they have a EULA I don't think that should be binding in stopping me from doing what I want with my product.

The idea of buying a license is a bit more of a grey point for me. Farmers have no obligation to buy their products, so the option they take is to enter into the contract willingly. That said I have no obligation to buy a computer with a EULA.

The point with the seeds is complicated by a few factors. First most seeds that farmers grow are the production of two different strains and are only viable with their characteristics for a single generation. Which is to say, even with non contract seeds farmers don't try and grow their own seed because they just don't work. Another factor to consider is that farmers are in no way obligated to keep using the seeds if they don't like it. Unlike some of the more complex agreements the seed producer has no control over what the farmer does other than with their seed.

An example of a complex agreement is a large potato producer that gets to control ever aspect of the farm production in exchange for fixed prices, and guaranteed purchase volumes. The farmer literally has to do whatever the producer tells them for the duration of the contract, right down to when to water, and what type of tractor.

It's OK that you don't know the difference between crossbreeding and modern GM technologies, but that nonsense about getting rich by proving negative effects of GMOs we can't let slide. Where is the money coming from to defend lawsuits from Monsanto, let alone to make any profits?
articles.latimes.com/2011/feb/13/opinion/la-oe-guriansherman-seeds-20110213

>GMO's are great. Monsanto however is a greedy corporation that has no intention of actually sharing the GMO food they grow.

They don't grow food, they sell seeds and chemicals used in farming.

i really do believe in my heart monsanto and gmos are evil. so debating a pro-gmo shill would be like making a deal with satan. GET THE HINT SATAN!!!

How are they greedy

>everyone who disagrees with me is a shill

just kill yourself

Are you Alex Jones?