If ancestry doesn't matter, only the country you were born in...

If ancestry doesn't matter, only the country you were born in, does that mean that the children of rapefugees are full blooded Europeans?

Other urls found in this thread:

youtube.com/watch?v=2J5n8kzpbCs
twitter.com/SFWRedditImages

>ancestry doesn't matter
>full BLOODED europeans
dumb muttposter

legally speaking, yes

So what you're saying is that someone in Minnesota whose ancestry consists entirely of Swedish and Germans is less European than Abdula the son of a Syrian goat farmer as long as Abdula was born in Europe?

In a lot of ways, yes.

That's all I wanted to know. Inshallah, PBUY.

legally speaking, yes

la creatura...

I got it, Ahmed. Enjoy your prayer.

...

>only the country you were born in
As if that matters. It's the country you grew up in that is important.

>Trump voter

>gaming shirts
good job you found some neets from Sup Forums

If ancestry doesn't matter, than there is no need for race based affirmative action policies.

Ancestry in Europe is a mean to preserve a culture, with its traditions/values, as such things are an expression of the blood inhabiting the land, and ultimately to provide your descendants a place they can truly call home. Your people fled from Europe first, then from every corner of the world, building a system of values designed to give this Mutting Pot a reason to abandon group-interests and avoid tribalism. That's why ancestry don't matter in your case and why it seems silly to us, how you boast about your superiority and never miss the chance to remark the fundamental differences between you and the Old Worlders and take pride in the fact your country's recent history consisted in fucking over Old Worlders, yet can't wait to find out you're 1/27 German, buy some cheap costume like Kyle did
youtube.com/watch?v=2J5n8kzpbCs
and spend your holidays in Bavaria among "your ancestors", from which you expect to claim all the achievements and to which you try to export all the poisonous ideas* (*see muh individualism and muh alt-right white pride, with its broad definitions and criteria fitting whatever percentage your misterymeat-test detected).

That's a lot of words to say "Syrian refugees are white"

Take your adderal

Man, I wish I had some speed.

Same desu How much is it per gram there?

I have no idea. I haven't done drugs since college.

>call america a mutting pot
>when the entirity of southern italy is arabia
please kill yourself

WTF i totally didn't see this coming, my post makes no sense now

more than you will ever be, el monstruo

oh yeah, these people look real white

>what is jus soli and jus sanguinis

more european than you, Tyler

>legally
who cares?

no

nobody says ancestry doesnt matter, but just having it and nothing else isnt enough to claim any greater kinship

While other countries can proudly say
>I’m 95% Italian
>I’m 82% English
>I’m 85% French
>I’m 82% German
Americans have to fall back on
>My country is 56% WHITE if you count Arabs as white
This is your country, no heritage, no culture.
Your education is shit, your states are shit, your mental health system is shit, you spread war and destruction over the world while spreading degenerate and disgusting culture in countries you occupy.
Corrupting the original countries culture and replacing it with Hip Hop, McDonalds and Blacked.com.
Then they turn around and say
>how is yor country sooo cucked
>haha 4% muslim lol Germanistan
>look this article made by an American thst means Germany is KEKED MAGA

LMAO

I grew up some in USA some in England, am I half British?

t. proud Turkish """"""""""German"""""""""

Typical whiter than you muhammed post

...

Make me a doner and shut up

>itt

The reason their European ethnicites in the states is shit.
Becuase they just put all European descendants as white.
Ethnicity doesn't matter to the white people here. Only race.
Thats why its funny to see them get BTFO'd.
> muh 1/4 german
> muh 1/4 scottish
> muh 1/4 Ukranian
> muh 1/4 french
All Euros and people globally laugh at those without culture

> with Hip Hop, McDonalds and Blacked.com.
Why thats the amrican dream jorge'

If you don't like it here, then why are you in America? Leave.

Go get your foodstamps

half burger half bong
full mutt

but my last name is Finnish :)))

das Monstrum...

ok but I'm just getting started mr Finish :))))))))

go get your empire
oh wait you lost it because you're shit at fighting wars

It's not that the goat farmer is European, it's that the American has framed the question in such a way as to imply that he's moreso, when in reality they're both equally foreign. Blood counts for very little in the real world. Americans stick out like sore thumbs even in English-speaking parts of Europe.

Even in this shithole situated in the asscrack of Europe, you won't get shot by police, gangs or angry neighbours, you can buy alcohol if you're 18, without hiding it in plastic bags, and standing in one place for a protracted time period is actually not a crime

are most of you runts actually mixed? I hate everyone descended from industrial era mongrels

Depends. What culture defined you more?

So the only way to have a culture is to inbreed for centuries and never leave the tiny area you grew up in.
>UK flag
makes sense

My personality is more British I suppose, fit in better over there but it's not like it's that different than here in upper peninsula Michigan

That's quite a bit of speech just to say you are a disgusting fennosw*De subhuman.

Go learn spanish lol
Look at the former axis powers
Number 3 and 4
Only under two countries 1 20 times larger then both of them and dominating the western world for 70 years and the other one also 20 times as larger than both of them and killing the old screaming eagle
eating it
consuming it
Enjoy your new latinos who Trump legalized
and don’t forget to kiss the Israeli ass daily while they kill your citizens on a daily basis

SEETHING

you are

its kinda hard to not be a muh ancestry fag when I'm a 1st generation European and my name isn't even Americanized

Good one, Chip.

Start learning mandarin

Start learning English.
Oh wait, you already did, because America controls the world.

I don't think I ever mentioned the word "culture" anywhere, in fact I don't know where you've pulled any of that from my post at all. But whatever Americans are, it's not "European", after all if user's great-grandpa Helmut the dirt farmer had loved Europe so much he wouldn't've ran away to the States to begin with.

It doesn't take long for the corruption to initiate. That is why European tourists can't stay there for any longer period of time

Go die for Israel

indeed, mr rape capital of Europe

Um, sweetie, we use robots to fight our wars. Hey, how did that final solution work out for you? It's a good thing you guys tried to exterminate the Jews, or Israel probably wouldn't exist.

Go die for Israel

I know I know. "whiter than you mohammed"

You're repeating yourself. I understand you're angry, but at least try to make this fun.

...

Go die for Saudi oil

no worries the mutt process will be complete once you have kids in america
I can already see little O'Neills tweeting how boston is more irish than Ireland

If Germany is so great, then why does my country have military bases in yours, and not the other way around?
kek, look at that pure white German

>Hip Hop, McDonald's and Blacked.com
Laughed

>you wuz losertz
Der Amerikaner...

You didn't answer my question. If Germany is superior to America, why are there no German military bases here?

If America is so superior to Germany, why is a Hamburger called Hamburger.
t. you

>superiority is based on military bases
Classic shart post

Gurb daaa Hurp Hurp

Because all the best Germans left and came to America. The last smart Germans were kidnapped after WWII and allowed America to go to the moon. Deal with it, fag.
If one country has a military presence in another, then I would say that the country being occupied by foreign soldiers is inferior.

no they didn't dipshit

>Because all the best Germans left and came to America.
LMAO do you mean the poor farmers or the wacky protestants, Amish and proto-Mormons?

So you're saying that you can't even win a war against your own rejects? Sad.

>proto-Mormons
>Germans

what are you talking about? Do you mean Pietists or something?

+1 black gene has been spliced into your DNA
AAGTACCATAAGGTCAGCCTGT

>americans are brown
>yuros are following suit and becoming brown
>leafs are yellow
Whos white anymore?

>Do you mean Pietists or something?

Pietists are a good example for wacky protestants.

>my last name is finnish
>"can you speak finnish? Do you know anything about Finnish history?"
>IT'S A DIVIDE AND CONCUR SOROS SHILL AAAAAAGGGHHHHHHH

when the earth is 100% black and whoever gets to claim the KANGZ OF EUROPE will be considered white

who even wants to be wh*te anymore? The time of pasty cumskins is over
The future is coloured

you said Proto-Mormons and I'm asking you to define what you mean. I can only vaguely suspect you're talking about the Moravians or the Schwarzenau Brethren and their splinters, or even the later Communistic societies. But none of that makes sense

this is the worst shart post I have ever read

I named the Mormons because some of my relatives oversea joined them in Ohio alongside many other Germans. They were all followers of non-mainstream protestantism at this point. I must admit it doesn't make sense on a more general scale.

Neither ancestry nor geography are important, all that matters is sacrifice in service of Kara Boga

"A bottle of juice is no excuse; the truth hurts."
-Tupac

Yeah that those Germans are dead now and your empire starts to crumble
Also Tupac is Serbian

>whiter than you ahmed

>if I greentext something that means it isn't true

I am whiter than southern Italians. Not that that's hard to do.

>Race doesn't matter, culture does

I speak a little finnish and know finnish history from my grandparents

...

Dios mio los goblinos